90
|
ChemGenes corporation
barcoded bead, sequence (5’ to 3’): toyopearl-linker-beads- tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30); Barcoded Bead, Sequence (5’ To 3’): Toyopearl Linker Beads Tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30);, supplied by ChemGenes corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/barcoded bead, sequence (5’ to 3’): toyopearl-linker-beads- tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30);/product/ChemGenes corporation Average 90 stars, based on 1 article reviews
barcoded bead, sequence (5’ to 3’): toyopearl-linker-beads- tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30); - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
ChemGenes corporation
barcoded beads seqb Barcoded Beads Seqb, supplied by ChemGenes corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/barcoded beads seqb/product/ChemGenes corporation Average 90 stars, based on 1 article reviews
barcoded beads seqb - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Becton Dickinson
barcoded bead suspension Barcoded Bead Suspension, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/barcoded bead suspension/product/Becton Dickinson Average 90 stars, based on 1 article reviews
barcoded bead suspension - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
ChemGenes corporation
primer coated barcoded bead seqb Primer Coated Barcoded Bead Seqb, supplied by ChemGenes corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer coated barcoded bead seqb/product/ChemGenes corporation Average 90 stars, based on 1 article reviews
primer coated barcoded bead seqb - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
86
|
Spatial Transcriptomics Inc
dna barcode bead arrays Dna Barcode Bead Arrays, supplied by Spatial Transcriptomics Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dna barcode bead arrays/product/Spatial Transcriptomics Inc Average 86 stars, based on 1 article reviews
dna barcode bead arrays - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |