bead barcoding Search Results


90
10X Genomics emulsion beads
Emulsion Beads, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/emulsion beads/product/10X Genomics
Average 90 stars, based on 1 article reviews
emulsion beads - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
10X Genomics chromium next gel bead-in emulsions with barcoding for cell surface protein
Chromium Next Gel Bead In Emulsions With Barcoding For Cell Surface Protein, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/chromium next gel bead-in emulsions with barcoding for cell surface protein/product/10X Genomics
Average 90 stars, based on 1 article reviews
chromium next gel bead-in emulsions with barcoding for cell surface protein - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
ChemGenes corporation barcoded beads seqb
Barcoded Beads Seqb, supplied by ChemGenes corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/barcoded beads seqb/product/ChemGenes corporation
Average 90 stars, based on 1 article reviews
barcoded beads seqb - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Illumina Inc bead-based barcode partitioning in a single tube
Bead Based Barcode Partitioning In A Single Tube, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bead-based barcode partitioning in a single tube/product/Illumina Inc
Average 90 stars, based on 1 article reviews
bead-based barcode partitioning in a single tube - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
10X Genomics droplet-based gel-bead barcoding system
Droplet Based Gel Bead Barcoding System, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/droplet-based gel-bead barcoding system/product/10X Genomics
Average 90 stars, based on 1 article reviews
droplet-based gel-bead barcoding system - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Becton Dickinson barcoded bead suspension
Barcoded Bead Suspension, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/barcoded bead suspension/product/Becton Dickinson
Average 90 stars, based on 1 article reviews
barcoded bead suspension - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Illumina Inc histogram of hamming distance between illumina and bead barcode matches
Histogram Of Hamming Distance Between Illumina And Bead Barcode Matches, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/histogram of hamming distance between illumina and bead barcode matches/product/Illumina Inc
Average 90 stars, based on 1 article reviews
histogram of hamming distance between illumina and bead barcode matches - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Illumina Inc seq-well s 3 bead barcodes
Seq Well S 3 Bead Barcodes, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/seq-well s 3 bead barcodes/product/Illumina Inc
Average 90 stars, based on 1 article reviews
seq-well s 3 bead barcodes - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Illumina Inc holographically barcoded veracodetm micro-bead platform
Holographically Barcoded Veracodetm Micro Bead Platform, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/holographically barcoded veracodetm micro-bead platform/product/Illumina Inc
Average 90 stars, based on 1 article reviews
holographically barcoded veracodetm micro-bead platform - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
10X Genomics droplet encapsulating the cell and the barcoded gel bead
Droplet Encapsulating The Cell And The Barcoded Gel Bead, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/droplet encapsulating the cell and the barcoded gel bead/product/10X Genomics
Average 90 stars, based on 1 article reviews
droplet encapsulating the cell and the barcoded gel bead - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
ChemGenes corporation barcoded bead, sequence (5’ to 3’): toyopearl-linker-beads- tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30);
Barcoded Bead, Sequence (5’ To 3’): Toyopearl Linker Beads Tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30);, supplied by ChemGenes corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/barcoded bead, sequence (5’ to 3’): toyopearl-linker-beads- tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30);/product/ChemGenes corporation
Average 90 stars, based on 1 article reviews
barcoded bead, sequence (5’ to 3’): toyopearl-linker-beads- tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30); - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
ChemGenes corporation primer coated barcoded bead seqb
Primer Coated Barcoded Bead Seqb, supplied by ChemGenes corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer coated barcoded bead seqb/product/ChemGenes corporation
Average 90 stars, based on 1 article reviews
primer coated barcoded bead seqb - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results