90
|
10X Genomics
emulsion beads Emulsion Beads, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/emulsion beads/product/10X Genomics Average 90 stars, based on 1 article reviews
emulsion beads - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
10X Genomics
chromium next gel bead-in emulsions with barcoding for cell surface protein Chromium Next Gel Bead In Emulsions With Barcoding For Cell Surface Protein, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/chromium next gel bead-in emulsions with barcoding for cell surface protein/product/10X Genomics Average 90 stars, based on 1 article reviews
chromium next gel bead-in emulsions with barcoding for cell surface protein - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
ChemGenes corporation
barcoded beads seqb Barcoded Beads Seqb, supplied by ChemGenes corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/barcoded beads seqb/product/ChemGenes corporation Average 90 stars, based on 1 article reviews
barcoded beads seqb - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Illumina Inc
bead-based barcode partitioning in a single tube Bead Based Barcode Partitioning In A Single Tube, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/bead-based barcode partitioning in a single tube/product/Illumina Inc Average 90 stars, based on 1 article reviews
bead-based barcode partitioning in a single tube - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
10X Genomics
droplet-based gel-bead barcoding system Droplet Based Gel Bead Barcoding System, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/droplet-based gel-bead barcoding system/product/10X Genomics Average 90 stars, based on 1 article reviews
droplet-based gel-bead barcoding system - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Becton Dickinson
barcoded bead suspension Barcoded Bead Suspension, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/barcoded bead suspension/product/Becton Dickinson Average 90 stars, based on 1 article reviews
barcoded bead suspension - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Illumina Inc
histogram of hamming distance between illumina and bead barcode matches Histogram Of Hamming Distance Between Illumina And Bead Barcode Matches, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/histogram of hamming distance between illumina and bead barcode matches/product/Illumina Inc Average 90 stars, based on 1 article reviews
histogram of hamming distance between illumina and bead barcode matches - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Illumina Inc
seq-well s 3 bead barcodes Seq Well S 3 Bead Barcodes, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/seq-well s 3 bead barcodes/product/Illumina Inc Average 90 stars, based on 1 article reviews
seq-well s 3 bead barcodes - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Illumina Inc
holographically barcoded veracodetm micro-bead platform Holographically Barcoded Veracodetm Micro Bead Platform, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/holographically barcoded veracodetm micro-bead platform/product/Illumina Inc Average 90 stars, based on 1 article reviews
holographically barcoded veracodetm micro-bead platform - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
10X Genomics
droplet encapsulating the cell and the barcoded gel bead Droplet Encapsulating The Cell And The Barcoded Gel Bead, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/droplet encapsulating the cell and the barcoded gel bead/product/10X Genomics Average 90 stars, based on 1 article reviews
droplet encapsulating the cell and the barcoded gel bead - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
ChemGenes corporation
barcoded bead, sequence (5’ to 3’): toyopearl-linker-beads- tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30); Barcoded Bead, Sequence (5’ To 3’): Toyopearl Linker Beads Tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30);, supplied by ChemGenes corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/barcoded bead, sequence (5’ to 3’): toyopearl-linker-beads- tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30);/product/ChemGenes corporation Average 90 stars, based on 1 article reviews
barcoded bead, sequence (5’ to 3’): toyopearl-linker-beads- tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30); - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
ChemGenes corporation
primer coated barcoded bead seqb Primer Coated Barcoded Bead Seqb, supplied by ChemGenes corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer coated barcoded bead seqb/product/ChemGenes corporation Average 90 stars, based on 1 article reviews
primer coated barcoded bead seqb - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |